Proofreading Results

Overview

Patent number: US20170280692
Title: ORGAN REGENERATION METHOD UTILIZING BLASTOCYST COMPLEMENTATION
Processing time: 4.7 seconds
Number of claims: 4 independent and 15 total
Claims for fees: 4 independent and 15 total (excluding canceled and including multiple dependencies)
Abstract: 117 words
With our Word add-in, you can access our tools directly in Word. See our installation instructions for more information.

Claim Tree

  • Claim 1
    • Claim 2
    • Claim 3
    • Claim 4
    • Claim 5
    • Claim 6
    • Claim 7
    • Claim 8
    • Claim 9
    • Claim 10
    • Claim 15
  • Claim 11
  • Claim 12
  • Claim 13
    • Claim 14

Numbering and Dependency Errors

Claim should depend from most recent independent claim.
15. The method according to claim 1, wherein the cell is from a rat, and the non-human mammal is from a mouse.

Antecedent Basis Errors

Click on a yellow, red, or red-underlined phrase below, and we'll help you diagnose the error.
  • Underline: Indefinite noun phrases for diagnosing errors.
  • Green Highlight: We found an exact match so likely no AB error (you should confirm).
  • Yellow Highlight: We found a partial match so there may be an AB error.
  • Red Highlight: We did not find a partial match so there is likely an AB error.
  • Red Underline: We found a possibly ambiguous noun phrase (many false alarms for this).

1.A method for producing a target organ in the living body of a non-human mammal having an abnormality associated with a lack of development of the target organ in the development stage, the target organ being derived from an allogeneic and/or xenogeneic mammal that is an individual different from the non-human mammal, the method comprising:
a) preparing a cell derived from the allogeneic and/or xenogeneic mammal;
b) transplanting the cell into a blastocyst stage fertilized egg of the non-human mammal;
c) developing the fertilized egg in the womb of a non-human surrogate parent mammal to obtain a litter; and
d) obtaining the target organ from an individual of the litter.

2.The method according to claim 1, wherein the cell is an embryonic stem cell (ES cell) or an induced pluripotent stem cell (iPS cell).

3.The method according to claim 1, wherein the cell is derived from a mouse.

4.The method according to claim 1, wherein the organ to be produced is selected from a kidney, a pancreas, thymus and hair.

5.The method according to claim 1, wherein the non-human mammal is a mouse.

6.The method according to claim 1, wherein the mouse is a Sall1 knockout mouse, a Pdx-1 knockout mouse, or a nude mouse.

7.The method according to claim 1, wherein the target organ is completely derived from the allogeneic and/or xenogeneic mammal.

8.The method according to claim 1, wherein the cell is derived from a rat.

9.The method according to claim 1, wherein the cell and the non-human mammal are heterologous to each other.

10.The method according to claim 1, wherein the cell is from a rat, and the non-human mammal is from a mouse.

11.A non-human mammal having an abnormality associated with a lack of development of a target organ in the development stage, produced according to a method comprising:
a) preparing a cell derived from an allogeneic and/or xenogeneic mammal that is an individual different from the non-human mammal;
b) transplanting the cell into a blastocyst stage fertilized egg of the non-human mammal; and
c) developing the fertilized egg in the womb of a non-human surrogate parent mammal to obtain a litter.

12.Use of a non-human mammal having an abnormality associated with a lack of development of a target organ in the development stage, for the generation of the target organ.

13.A set for producing a target organ, the set comprising:
A) a non-human mammal having an abnormality associated with a lack of the target organ development in the development stage; and
B) a cell derived from an allogeneic and/or xenogeneic mammal of the same species as the non-human mammal.

14.The set according to claim 13, wherein the cell and the non-human mammal are heterologous to each other.

15.The method according to claim 1, wherein the cell is from a rat, and the non-human mammal is from a mouse.

Word Support in Detailed Description

Word Support in Entire Specification

Hover over any highlighted word to see support details.
Click any green or yellow word to see paragraphs providing support.
  • Green Highlight: Word appears more than 5 times.
  • Yellow Highlight: Word appears 1-5 times.
  • Red Highlight: Word not in spec.

Toggle between showing support in the detailed description section and the entire specification:

1.A method for producing a target organ in the living body of a non-human mammal having an abnormality associated with a lack of development of the target organ in the development stage, the target organ being derived from an allogeneic and/or xenogeneic mammal that is an individual different from the non-human mammal, the method comprising:
a) preparing a cell derived from the allogeneic and/or xenogeneic mammal;
b) transplanting the cell into a blastocyst stage fertilized egg of the non-human mammal;
c) developing the fertilized egg in the womb of a non-human surrogate parent mammal to obtain a litter; and
d) obtaining the target organ from an individual of the litter.

2.The method according to claim 1, wherein the cell is an embryonic stem cell (ES cell) or an induced pluripotent stem cell (iPS cell).

3.The method according to claim 1, wherein the cell is derived from a mouse.

4.The method according to claim 1, wherein the organ to be produced is selected from a kidney, a pancreas, thymus and hair.

5.The method according to claim 1, wherein the non-human mammal is a mouse.

6.The method according to claim 1, wherein the mouse is a Sall1 knockout mouse, a Pdx-1 knockout mouse, or a nude mouse.

7.The method according to claim 1, wherein the target organ is completely derived from the allogeneic and/or xenogeneic mammal.

8.The method according to claim 1, wherein the cell is derived from a rat.

9.The method according to claim 1, wherein the cell and the non-human mammal are heterologous to each other.

10.The method according to claim 1, wherein the cell is from a rat, and the non-human mammal is from a mouse.

11.A non-human mammal having an abnormality associated with a lack of development of a target organ in the development stage, produced according to a method comprising:
a) preparing a cell derived from an allogeneic and/or xenogeneic mammal that is an individual different from the non-human mammal;
b) transplanting the cell into a blastocyst stage fertilized egg of the non-human mammal; and
c) developing the fertilized egg in the womb of a non-human surrogate parent mammal to obtain a litter.

12.Use of a non-human mammal having an abnormality associated with a lack of development of a target organ in the development stage, for the generation of the target organ.

13.A set for producing a target organ, the set comprising:
A) a non-human mammal having an abnormality associated with a lack of the target organ development in the development stage; and
B) a cell derived from an allogeneic and/or xenogeneic mammal of the same species as the non-human mammal.

14.The set according to claim 13, wherein the cell and the non-human mammal are heterologous to each other.

15.The method according to claim 1, wherein the cell is from a rat, and the non-human mammal is from a mouse.

1.A method for producing a target organ in the living body of a non-human mammal having an abnormality associated with a lack of development of the target organ in the development stage, the target organ being derived from an allogeneic and/or xenogeneic mammal that is an individual different from the non-human mammal, the method comprising:
a) preparing a cell derived from the allogeneic and/or xenogeneic mammal;
b) transplanting the cell into a blastocyst stage fertilized egg of the non-human mammal;
c) developing the fertilized egg in the womb of a non-human surrogate parent mammal to obtain a litter; and
d) obtaining the target organ from an individual of the litter.

2.The method according to claim 1, wherein the cell is an embryonic stem cell (ES cell) or an induced pluripotent stem cell (iPS cell).

3.The method according to claim 1, wherein the cell is derived from a mouse.

4.The method according to claim 1, wherein the organ to be produced is selected from a kidney, a pancreas, thymus and hair.

5.The method according to claim 1, wherein the non-human mammal is a mouse.

6.The method according to claim 1, wherein the mouse is a Sall1 knockout mouse, a Pdx-1 knockout mouse, or a nude mouse.

7.The method according to claim 1, wherein the target organ is completely derived from the allogeneic and/or xenogeneic mammal.

8.The method according to claim 1, wherein the cell is derived from a rat.

9.The method according to claim 1, wherein the cell and the non-human mammal are heterologous to each other.

10.The method according to claim 1, wherein the cell is from a rat, and the non-human mammal is from a mouse.

11.A non-human mammal having an abnormality associated with a lack of development of a target organ in the development stage, produced according to a method comprising:
a) preparing a cell derived from an allogeneic and/or xenogeneic mammal that is an individual different from the non-human mammal;
b) transplanting the cell into a blastocyst stage fertilized egg of the non-human mammal; and
c) developing the fertilized egg in the womb of a non-human surrogate parent mammal to obtain a litter.

12.Use of a non-human mammal having an abnormality associated with a lack of development of a target organ in the development stage, for the generation of the target organ.

13.A set for producing a target organ, the set comprising:
A) a non-human mammal having an abnormality associated with a lack of the target organ development in the development stage; and
B) a cell derived from an allogeneic and/or xenogeneic mammal of the same species as the non-human mammal.

14.The set according to claim 13, wherein the cell and the non-human mammal are heterologous to each other.

15.The method according to claim 1, wherein the cell is from a rat, and the non-human mammal is from a mouse.

Phrase Support in Detailed Description

You can check other phrases by selecting any sequence of words in the claims below with your mouse.
Click any green or yellow phrase to see paragraphs providing support.
  • Green Highlight: Phrase appears more than 5 times.
  • Yellow Highlight: Phrase appears 1-5 times.
  • Red Highlight: Phrase not in spec.

Phrase:

Count:

1.A method for producing a target organ in the living body of a non-human mammal having an abnormality associated with a lack of development of the target organ in the development stage, the target organ being derived from an allogeneic and/or xenogeneic mammal that is an individual different from the non-human mammal, the method comprising:
a) preparing a cell derived from the allogeneic and/or xenogeneic mammal;
b) transplanting the cell into a blastocyst stage fertilized egg of the non-human mammal;
c) developing the fertilized egg in the womb of a non-human surrogate parent mammal to obtain a litter; and
d) obtaining the target organ from an individual of the litter.

2.The method according to claim 1, wherein the cell is an embryonic stem cell (ES cell) or an induced pluripotent stem cell (iPS cell).

3.The method according to claim 1, wherein the cell is derived from a mouse.

4.The method according to claim 1, wherein the organ to be produced is selected from a kidney, a pancreas, thymus and hair.

5.The method according to claim 1, wherein the non-human mammal is a mouse.

6.The method according to claim 1, wherein the mouse is a Sall1 knockout mouse, a Pdx-1 knockout mouse, or a nude mouse.

7.The method according to claim 1, wherein the target organ is completely derived from the allogeneic and/or xenogeneic mammal.

8.The method according to claim 1, wherein the cell is derived from a rat.

9.The method according to claim 1, wherein the cell and the non-human mammal are heterologous to each other.

10.The method according to claim 1, wherein the cell is from a rat, and the non-human mammal is from a mouse.

11.A non-human mammal having an abnormality associated with a lack of development of a target organ in the development stage, produced according to a method comprising:
a) preparing a cell derived from an allogeneic and/or xenogeneic mammal that is an individual different from the non-human mammal;
b) transplanting the cell into a blastocyst stage fertilized egg of the non-human mammal; and
c) developing the fertilized egg in the womb of a non-human surrogate parent mammal to obtain a litter.

12.Use of a non-human mammal having an abnormality associated with a lack of development of a target organ in the development stage, for the generation of the target organ.

13.A set for producing a target organ, the set comprising:
A) a non-human mammal having an abnormality associated with a lack of the target organ development in the development stage; and
B) a cell derived from an allogeneic and/or xenogeneic mammal of the same species as the non-human mammal.

14.The set according to claim 13, wherein the cell and the non-human mammal are heterologous to each other.

15.The method according to claim 1, wherein the cell is from a rat, and the non-human mammal is from a mouse.

Reference Label Inconsistencies

Click any reference label or text to see matching paragraphs.
  • Label — A label that was found in the spec or in the drawings.
  • Detailed Description — Text associated with the label and a count of how many times it occurred. If No, the label was not present or was present but did not have any relevant text before it.

Missing ref labels? We look for "strict" ref labels by default. See our documentation for more information.

We did not find any reference label errors. Good work!

Label Detailed Description
Label Text Count
122 development 1
1323 having 1
1993 tijssen 1
1995 Oxford University Press 1

Figure Number Inconsistencies

  • Brief Description — The figure number was included in the Brief Description of the Figures section of the specification.
  • Detailed Description — The figure number was used later in the specification.

We look for figure numbers that are a number optionally followed by a letter. Let us know if you use other formats and we can try to extend this.

Figure Brief
Description
Detailed
Description
1A Yes Yes
1B Yes Yes
2A Yes Yes
2B Yes Yes
2C Yes Yes
3 Yes Yes
4A Yes No
4B Yes Yes
4C Yes Yes
4D Yes No
5A Yes No
5B Yes Yes
5C Yes Yes
6A Yes No
6B Yes Yes
6C Yes No
6D Yes No
7 Yes Yes
8 Yes Yes
9 Yes Yes
10 Yes Yes
11 Yes Yes
12 Yes Yes
13 Yes Yes
14 Yes Yes
15 Yes Yes
16 Yes Yes
17 Yes Yes
18 Yes Yes
19 Yes Yes
20A Yes Yes
20B Yes No

Patent Profanity

You can uncheck individual words below to focus on the limiting words that are important to you. See list of profane words:

  • absolute (1)
  • all (14)
  • certain (11)
  • definitive (1)
  • each (13)
  • embodiment (2)
  • embodiments (7)
  • entire (4)
  • entirety (1)
  • essential (2)
  • every (2)
  • highest (2)
  • important (3)
  • invention (70)
  • key (4)
  • least (16)
  • most (2)
  • necessary (10)
  • need (1)
  • needed (1)
  • obvious (2)
  • only (27)
  • preferred (2)
  • required (1)
  • should (13)
  • valuable (3)
  • very (4)

CROSS-REFERENCE TO RELATED APPLICATION

[0001] This application is a continuation of U.S. Ser. No. 12/583,559, filed Aug. 21, 2009 (abandoned) which is a continuation-in-part of PCT/JP2008/051129, filed Jan. 25, 2008; which claimed a continuation-in-part of PCT/JP2008/051129, filed Jan. 25, 2008; which claimed priority under Title 35, United States Code, §119 to Japanese Patent Application No. 2007-042041, filed on Feb. 22, 2007, and Japanese Patent Application No. 2007-311786, filed on Nov. 30, 2007; all of which are incorporated herein by reference in their entireties.

BACKGROUND

Technical Field

[0002] The present invention relates to a method for producing an organ derived from a mammalian cell in vivo, using a cell derived from the organ to be produced, which is obtained from the same mammalian species.

Description of the Related Art

[0003] In discussing regenerative medicine that is practiced in the form of cell transplantation and organ transplantation, expectations for pluripotent stem cells are high. Embryonic stem cells (ES cells) derived from the inner cell mass of blastocyst stage fertilized eggs are pluripotential, and thus are widely used in the study of differentiation of various cells. Development of differentiation control methods of inducing differentiation of ES cells into specific cell lineages in vitro is a topic in the research of regenerative medicine.

[0004] In the study of in vitro differentiation using ES cells, ES cells are likely to differentiate into the mesoderm and the ectoderm, such as blood cells, blood vessels, cardiac muscles and nervous systems, in the early stage of embryonic development. However, a general tendency is known such that differentiation into organs directed by the formation of complicated tissue structures through intercellular interaction after the middle stage of embryonic development.

[0005] For example, metanephros, which is the adult kidney of mammals, develops from the intermediate mesoderm during the middle stage of embryonic development. Specifically, the development of kidney is initiated by the interaction between two components, namely, a mesenchymal cell and ureteric bud epithelium, and finally, the adult kidney is completed by the differentiation into multiple types of functional cells, which count as many as several dozen types that cannot be seen in other organs, and the constitution of complicated nephron structures centered around the glomeruli and uriniferous tubules, resulting from the differentiation. Considering the complexities of the development time and the development process of kidney, it can be easily conjectured that inducing a kidney from ES cells in vitro would be a very laborious and difficult work, and it is considered practically impossible. Furthermore, in organs such as the kidney, the identification of somatic stem cells is still not definitive, and the contribution of bone marrow cells to the reparation of injured kidneys, which was once vigorously studied, has been revealed to be insignificant.

[0006] When pluripotent ES cells are injected into the inner space of a blastocyst stage fertilized egg, the resulting individual forms a chimeric mouse. There has been previously reported a rescue experiment of T-cell and B-cell lineages by blastocyst complementation, to which this technique is applied, in a Rag-2 knockout mouse deficient in T-cell and B-cell lineages (Non-Patent Document 1). This chimeric mouse assay is used as an in vivo assay system for verifying the differentiation of the T-cell lineage, which cannot be provided by in vitro assay systems.

[0007] However, even if such a technique is found to be effective in a certain organ, it is difficult to predict whether the technique will also be effective in other organs, because of the difference in the function of the organs in a living body, for example, the difference in fatality resulting from the absence of the organs, and various factors affect the validity of the technique. In addition, the deficient gene of the organ deficiency model selected in this instance is also an important factor. This is because it is required to select transcription factors that are essential for the function of the deficient genes during the development process, particularly for the differentiation and maintenance of stem/precursor cells of each organ during the process of organ formation.

[0008] It is expected that when a model representing organ deficiency caused by the deficiency of a humoral factor or a secretion factor is to be used, only the factors released are complemented by the factors released from the ES cell-derived cells, and a chimeric state is adopted at the level of the organ.

[0009] Accordingly, selection of an appropriate model animal for an organ is the key factor in the present invention, and upon considering the application to other organs, it is considered problematic to use a model showing the same phenotype as that of the embodiments of the present invention with respect to other organs. Non-Patent Document 1: Chen J., et al., Proc. Natl. Aca. Sci. USA, Vol. 90, pp. 4528-4532, 1993 Non-Patent Document 2: Nishinakamura, R. et al., Development, Vol. 128, pp. 3105-3115, 2001 Non-Patent Document 3: Offield, M. F., et al., Development, Vol. 122, pp. 983-995, 1996 Non-Patent Document 4: McMahon, A. P. and Bradley, A., Cell, Vol. 62, pp. 1073-1085, 1990 Non-Patent Document 5: Kimura, S., et al., Genes and Development, Vol. 10, pp. 60-69, 1996 Non-Patent Document 6: Celli, G., et al., EMBO J., Vol. 17, pp. 1642-655, 1998 Non-Patent Document 7: Takasato, M., et al., Mechanisms of Development, Vol. 121, pp. 547-557, 2004 Non-Patent Document 8: Mulnard, J. G., C. R. Acad. Sci. Paris. 276, 379-381 (1973) Non-Patent Document 9: Stern, M. S., Nature. 243, 472-473 (1973) Non-Patent Document 10: Tachi, S. & Tachi, C. Dev. Biol. 80, 18-27 (1980) Non-Patent Document 11: Zeilmarker, G., Nature, 242, 115-116 (1973) Non-Patent Document 12: Fehilly, C. B., et al., Nature, 307, 634-636 (1984) Non-Patent Document 13: Bevis B. J. and Glick B. S., Nature Biotechnology Vol. 20, pp. 83-87, 2002 Non-Patent Document 14: Poueymirou W T, et al., Nature Biotechnol. 2007 January; 25(1): 91-9

BRIEF SUMMARY

[0024] It is an object of the present invention to produce a mammalian organ having a complicated cellular constitution formed from multiple kinds of cells, such as kidney, pancreas, hair and thymus, in the living body of an animal, particularly, a non-human animal.

Means for Solving the Problems

[0025] The inventors of the present invention have applied the above-described chimeric animal assay to a novel generation method for solid organs. More specifically, the inventors have showed that a kidney, a pancreas, hair and a thymus can be newly produced by applying the above-described chimeric animal assay, specifically, by rescuing a model animal (a sall1 knockout mouse, a nude mouse, or the like) deficient of kidney, pancreas, hair or thymus because of the functional abnormality in the metanephric mesenchyme, which is differentiated into the most parts of an adult kidney, in a mouse in which LacZ gene has been knocked in (also knocked out) into the Pdx1 gene locus, through blastocyst complementation.

[0026] The deficient gene of the organ deficiency model selected herein is also an important factor, and selecting transcription factors that are essential for the functions of the deficient gene during the development process, particularly for the differentiation and maintenance of stem/precursor cells of each organ during the process of organ formation, has been a key factor of the present invention.

[0027] However, it will be understood that as long as the method of the present invention is found to be applicable to a certain organ, appropriate modifications can be applied to that organ, based on previous successful cases. This is because when there is an appropriate defective animal, and when the same analysis method is applied using fluorescent-labeled ES cells, iPS cells or the like as described in the present specification, it becomes clear of whether the constructed organ is derived from the host or from the ES cells, iPS cells or the like, and the success or failure of organ construction can be decided.

[0028] When a model representing organ deficiency caused by the deficiency of a humoral factor or a secretion factor is to be used, it has been expected that only the released factors are complemented by the factors released from the cells derived from ES cells, iPS cells or the like, and a chimeric state is adopted at the level of the organ. However, this time, a working system was found for a kidney, a pancreas, hair and thymus. Accordingly, in regard to these particular organs, those ordinarily skilled in the art can make appropriate modifications of design based on the information provided in the present specification. When making such modification of design, the following may be taken into consideration.

[0029] Another key in the present invention is the selection of a model that is completely deficient in an organ. There are many animals, such as mouse, exhibiting hypoplasia of organ when a single gene is deleted, owing to the level and redundancy of the gene expression. However, even in the case of using those animals, cells derived from ES cells, iPS cells or the like develop in cooperation with the native cells, and thus it is expected that a chimeric state is adopted at the level of the organ. Accordingly, selection of the model animal is a key factor in the present invention. Upon considering the application to other organs, it has been conceived that it is difficult to use a model exhibiting the same phenotype as that of the present invention with respect to other organs. However, this time, a working system has been found for a kidney, a pancreas, hair and thymus. Accordingly, in regard to these particular organs, those ordinarily skilled in the art can make appropriate modifications of design based on the information provided in the present specification.

[0030] In this regard, Non-Patent Document 14 describes a method for producing a novel knockout mouse. According to the method, an attempt has been made to produce a mouse which is derived from ES cells, iPS cells or the like completely from the first generation, by increasing contribution to the injection into an embryo in a stage preceding the blastocyst stage using a laser, and thus integrate individuals are produced. Therefore, generation of organs cannot be attempted.

[0031] Specifically, the present invention provides a method for producing a target organ in the living body of a non-human mammal having an abnormality associated with a lack of development of the target organ in the development stage, the target organ being derived from an allogeneic and/or xenogeneic mammal that is an individual different from the non-human mammal, the method including:

[0032] a) preparing a cell derived from the allogeneic and/or xenogeneic mammal;

[0033] b) transplanting the cell into a blastocyst stage fertilized egg of the non-human mammal;

[0034] c) developing the fertilized egg in the womb of a non-human surrogate parent mammal to obtain a litter; and

[0035] d) obtaining the target organ from an individual of the litter.

[0036] Thus, it has been found that the problems described above can be solved.

[0037] According to the present invention, cells to be transplanted are prepared in accordance with the species of animal for the organ to be produced. For example, if it is desired to produce a human organ, human-derived cells are prepared, and if it is desired to produce an organ of a mammal other than human, the mammal-derived cells are prepared. The cells to be transplanted according to the present invention are preferably cells having an ability to differentiate into the organ to be produced (totipotent cells or pluripotent cells), but they are not limited thereto. As the totipotent cells or pluripotent cells, embryonic stem cells (ES cells), induced pluripotent stem cells (iPS cells), somatic stem cells, cells of zygote inner cell mass, early embryonic cells, and the like may be used, but the cells are not limited thereto. For example, if it is desired to produce a human organ, induced pluripotent stem cells, multipotent germline stem cells, and the like may be used. Preferably, ES cells, or iPS cells having an ability equivalent thereto (Nature. 2007 Jul. 19; 448(7151):313-7; Cell. 2006 Aug. 25; 126(4):663-76) can be used. The cell to be transplanted according to the present invention may be from any origin, such as human, pig, rat, mouse, cattle, sheep, goat, horse, dog, chimpanzee, gorilla, orangutan, monkey, marmoset or bonobo.

[0038] The organ to be generated by the method of the present invention may be any solid organ with a fixed shape, such as kidney, heart, pancreas, cerebellum, lung, thyroid gland, hair or thymus, but the organ is preferably a kidney, a pancreas, hair, or a thymus. These solid organs are generated in the bodies of the litter, by developing totipotent cells or pluripotent cells within an embryo that serves as a recipient. Since the totipotent cells or pluripotent cells can form all kinds of organs when made to develop in an embryo, there is no restriction on the type of solid organ that can be generated depending on the type of the totiponent cells or pluripotent cells to be used.

[0039] On the other hand, the present invention is characterized in that an organ derived only from the transplanted cells is formed in the living body of an individual of the litter derived from a non-human embryo that serves as a recipient, and thus it is not desirable to have a chimeric cell composition of the cells derived from the recipient non-human embryo and the cells to be transplanted. Therefore, as for the recipient non-human embryo, it is desirable to use an embryo derived from an animal having an abnormality associated with a lack of development of the organ to be produced during the development stage, and the baby born therefrom is deficient of that organ. As long as the animal is an animal developing such organ deficiency, a knockout animal having organ deficiency as a result of the deficiency of a specific gene, or a transgenic animal having organ deficiency as a result of incorporating a specific gene may be used.

[0040] For example, in the case of producing a kidney as the organ, embryos of a Sal11 knockout animal having an abnormality in which the development of kidney does not occur during the development stage (Non-Patent Document 2), or the like, may be used as a recipient non-human embryo. In the case of producing a pancreas as the organ, embryos of a Pdx-1 knockout animal having an abnormality in which the development of pancreas does not occur during the development stage (Non-Patent Document 3), may be used as the recipient non-human embryo. In the case of producing a cerebellum as the organ, embryos of a Wnt-1 (int-1) knockout animal having an abnormality in which the development of cerebellum does not occur during the development stage (Non-Patent Document 4), may be used as the recipient non-human embryo. In the case of producing a lung or a thyroid gland as the organ, embryos of a T/ebp knockout animal having an abnormality in which the development of lung or thyroid gland does not occur during the development stage (Non-Patent Document 5), may be used as the recipient non-human embryo. Furthermore, embryos of a dominant negative-type transgenic variant animal model (Non-Patent Document 6) which overexpresses the deletion of an intracellular domain of fibroblast growth factor (FGF) receptor (FGFR), which causes deficiency of multiple organs including kidney, lung, and the like, may also be used. Alternatively, nude mice may also be used in the generation of hair or thymus.

[0041] The non-human animal as the origin of a recipient embryo as used in the present invention, may be any animal other than human, such as pig, rat, mouse, cattle, sheep, goat, horse, dog, chimpanzee, gorilla, orangutan, monkey, marmoset or bonobo. It is preferable to collect the embryos from a non-human animal having a size of adult that is similar to that of the animal species of the organ to be produced.

[0042] On the other hand, the mammal as the origin of the cell that is transplanted into a recipient blastocyst stage fertilized egg in order to form the organ to be produced, may be either a human or a mammal other than human, for example, pig, rat, mouse, cattle, sheep, goat, horse, dog, chimpanzee, gorilla, orangutan, monkey, marmoset or bonobo.

[0043] The recipient embryo and the cell to be transplanted may be in a homologous relationship or in a heterologous relationship. In one embodiment, the cell may be from a rat, and the non-human mammal may be a mouse

[0044] The cell to be transplanted, prepared as described above, can be transplanted in the inner space of the recipient blastocyst stage fertilized egg, and a chimeric cell mixture of a blastocyst-derived inner cell and the cell to be transplanted may be formed in the inner space of the blastocyst stage fertilized egg.

[0045] The blastocyst stage fertilized egg having a cell transplanted thereinto as described above, is transplanted in the womb of a pseudo-pregnant or pregnant female animal of the species from which the blastocyst stage fertilized egg serving as the surrogate parent is derived. This blastocyst stage fertilized egg is developed within the surrogate womb to obtain a litter. Then, a target organ can be obtained from this litter, as a mammalian cell-derived target organ.

[0046] The present invention is also intended to include a mammal produced according to the method of the present invention. The reason for including such an animal is that only the target organ has target genomes, and such chimera type mammals were not present in the past.

[0047] The present invention also provides a use of a non-human mammal having an abnormality associated with a lack of development of a target organ in the development stage, for the generation of the target organ.

[0048] The present invention also provides a set for producing a target organ. This set includes cells derived from: A) a non-human mammal having an abnormality associated with a lack of development of the target organ in the development stage, and B) a cell derived from an allogeneic and/or xenogeneic mammal that is an individual different from the non-human mammal.

[0049] Therefore, these and other advantages of the present invention will become apparent as the following detailed description is read.

Effects of the Invention

[0050] According to the method of the present invention, it was possible to form a certain organ derived from a mammalian cell, in the living body of an individual causing deficiency of the organ because the individual has an abnormality associated with a lack of development of the organ in the development stage. Particularly, the method of the present invention could be applied even to an organ having a complicated cellular constitution, such as kidney. When a kidney is formed, the formed kidney became a regenerated kidney in which nearly all of the metanephric mesenchyme-derived tissues, except for the ureteric bud, originated from the cell transplanted into the inner space of the blastocyst stage fertilized egg. In addition to the kidney, the pancreas, the thymus and the hair also became a regenerated pancreas, a regenerated thymus, and regenerated hair, respectively, originating from the cells transplanted into the inner space of the blastocyst stage fertilized egg.

BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWINGS

[0051] FIG. 1A-1B is a photograph showing kidney development in a normal individual (FIG. 1A), and kidney development in a Sall1 knockout mouse (Sall1(−/−)) (FIG. 1B). The upper side shows a macroscopic finding of the intraperitoneal cavity, and the lower side shows hematoxylin and eosin stained images of a median section slice of the renal part.

[0052] FIG. 2A-2C is a diagram showing the means for performing genotype determination for a homozygote knockout individual (Sall1(−/−)), a heterozygote individual (Sall1(+/−)), and a wild type individual (Sall1(+/+)). FIG. 2A is a diagram showing the detection of the expression of a GFP gene that has been knocked into the Sall1 gene locus, by fluorescence detection; FIG. 2B is a diagram showing that GFP-positive cells and GFP-negative cells can be discriminated by sorting with a cell sorter, based on GFP fluorescence; and FIG. 2C is a diagram showing that for the Sall1(−/−) cells, Sall1(+/−) cells, and Sall1(+/+) cells, the genotype can be determined by a PCR method.

[0053] FIG. 3 shows a GFP fluorescence developed image of the intraperitoneal cavity of an individual of a litter on the first day (P1) after birth.

[0054] FIG. 4A-4D shows the respective macroscopic findings, GFP fluorescence images (GFP), DsRed fluorescence images (DsRed), and superimposed fluorescence images of GFP and DsRed (Merge), for a heterozygote individual (Sall1(+/−)) (FIG. 4A); a homozygote knockout chimeric individual (Sall1(−/−)), in which a pluripotent cell (ES cell) incorporated with DsRed gene was transplanted into the inner space of a blastocyst stage fertilized egg (FIG. 4B); a heterozygote chimeric individual (Sall1(+/−)), in which a pluripotent cell (ES cell) incorporated with DsRed gene was transplanted into the inner space of a blastocyst stage fertilized egg (FIG. 4C); and a wild type chimeric individual (Sall1(+/+)), in which a pluripotent cell (ES cell) incorporated with DsRed gene was transplanted into the inner space of a blastocyst stage fertilized egg (FIG. 4D).

[0055] FIG. 5A-5C shows the respective macroscopic findings, and superimposed fluorescence images of GFP and DsRed, for a heterozygote individual (Sall1(+/−)) (FIG. 5A); a homozygote knockout chimeric individual (Sall1(−/−)), in which a pluripotent cell (ES cell) incorporated with DsRed gene was transplanted into the inner space of a blastocyst stage fertilized egg (FIG. 5B); and a heterozygote chimeric individual (Sall1(+/−)), in which a pluripotent cell (ES cell) incorporated with DsRed gene was transplanted into the inner space of a blastocyst stage fertilized egg (FIG. 5C).

[0056] FIG. 6A-6D shows the results of cell sorting of brain cells and kidney cells, for a heterozygote individual (Sall1(+/−)) (FIG. 6A); a homozygote knockout chimeric individual (Sall1(−/−)), in which a pluripotent cell (ES cell) incorporated with DsRed gene was transplanted into the inner space of a blastocyst stage fertilized egg (FIG. 6B); a heterozygote chimeric individual (Sall1(+/−)), in which a pluripotent cell (ES cell) incorporated with DsRed gene was transplanted into the inner space of a blastocyst stage fertilized egg (FIG. 6C); and a wild type chimeric individual (Sall1(+/+)), in which a pluripotent cell (ES cell) incorporated with DsRed gene was transplanted into the inner space of a blastocyst stage fertilized egg (FIG. 6D). The horizontal axis represents the fluorescence intensity of GFP, and the vertical axis represents the fluorescence intensity of DsRed. A gel electrophoresis image showing the results of genotype determination of the cells obtained from the brain derived from the homozygote knockout chimeric individual (Sall1(−/−)) (FIG. 6B), is shown together.

[0057] FIG. 7 shows the histological analysis of the kidney obtained as a result of transplanting a pluripotent cell (ES cell) into the inner space of a blastocyst stage fertilized egg of the homozygote (Sall1(−/−)).

[0058] FIG. 8 shows a method for production of a knockout mouse through Pdx1-Lac-Z knock-in and blastocyst complementation. An ES cell labeled with an epidermal growth factor protein (EGFP) is injected, under a microscope, into an embryo obtained by breeding Pdx1 hetero individuals. FIG. 8 is a conceptual diagram showing that the obtained individual is theoretically a knockout individual at a probability of ¼ according to Mendelian inheritance, and if contribution of the ES cell could be made, construction of a completely ES cell-derived pancreas is possible. As also disclosed in Development 1996 March; 122(3):983-95., it is known that the presence of the pancreas is confirmed in wt/Pdx1-LacZ, and the pancreas is absent in Pdx1-LacZ/Pdx1-LacZ.

[0059] FIG. 9 shows the experimental result of generation of pancreas through blastocyst complementation. From the left side, the number of injected ova, the number of transplanted embryos, the number of litter, the hair color, and the number of chimera determined from EGFP fluorescence under a fluorescent microscope are shown in a table. Since this is a line in which generally the generation is still progressing, the reduction of the incidence rate is found to be more than usual. However, the chimera ratio of the obtained mouse was sufficient to conduct the experiment. The numbers inside circles represent the order of conducting this experiment.

[0060] FIG. 10 shows an example of the mouse of the present invention having a pancreas produced by blastocyst complementation. The upper side shows a Pdx1-LacZ knock-in (knockout) mouse (homo), and the pancreas is not present. The middle side shows introduction of a GPFES cell into the blastocyst of a Pdx1-LacZ knock-in (knockout) mouse (hetero), and the pancreas is present and is very partially GPF-positive. The lower side shows introduction of a GPFES cell into the blastocyst of a Pdx1-LacZ knock-in (knockout) mouse (homo), and a pancreas derived from a GFP-positive ES cell can be seen.

[0061] FIG. 11 is a photograph showing a real example of hair growth from a nude mouse by BC (Example 3).

[0062] FIG. 12 shows a FACS analysis of peripheral blood. While CD4-positive, CD8-positive T-cells are present in the peripheral blood of a wild type mouse, they are not present in a nude mouse (since thymus is not present, the differentiation of matured T-cells is not induced). However, if normal ES cells marked with green fluorescent protein (GFP) are introduced into the blastocyst of the nude mouse (BC, blastocyst complementation), the differentiation of both of GFP-negative T-cells (derived from hematopoietic stem cells of nude mouse of a host) and GFP-positive T-cells (derived from ES cell) is induced, and thus, it is even functionally obvious that thymus is constructed by ES cells. B-cells exist even in the nude mouse, and there is no special change. GPF-positive B-cells are derived from the ES cells. From the upper side, a nude mouse, a wild type mouse, and a blastocyst chimeric mouse are represented. From the left side, FACS analysis results of T-cells, CD8+ cells, CD4+ cells, B-cells are shown.

[0063] FIG. 13 is a photograph showing the thymus of a wild type mouse.

[0064] FIG. 14 is a photograph taken when fluorescence is illuminated (negative) to the thymus of a wild type mouse.

[0065] FIG. 15 is a photograph of a nude mouse (no thymus exists).

[0066] FIG. 16 is a photograph showing illumination of fluorescence to the mouse of FIG. 15.

[0067] FIG. 17 is a photograph showing complementation of blastocyst of a nude mouse with GFP-marked ES cell in Example 4 (the thymus exists).

[0068] FIG. 18 is a photograph taken when fluorescence is illuminated to the mouse of FIG. 17 (GFP-positive thymus exists).

[0069] FIG. 19 is a photograph taken when fluorescence is illuminated to thymus taken out from the mouse of FIG. 7.

[0070] FIG. 20A shows male Pdx1(−/−) mice (founder: Pdx1(−/−) mouse with a pancreas complemented with murine iPS cell), and female Pdx1(+/−) mouse has been cross bred and a fertilized egg has been obtained. This egg has been grown to a blastocyst stage, and the resultant blastocyst was microinjected under microscope with 10 rat iPS cells marked with EGFP. This was transplanted in the womb of a pseudo-pregnant female animal. This blastocyst stage fertilized egg is developed within the surrogate womb to obtain a litter by Cesarean section in the stage where pregnancy is completed. Upon observation of EGFP fluorescence under fluorescent stereoscopic microscope, it turned out that litter numbers #1, #2 and #3 are chimeric based on the EGFP expression on the body surface. Upon the Cesarean section, pancreas had uniform expression of EGFP observed in #1 and #2, however, the pancreas of #3 exhibited partial expression of EGFP, in a mosaic manner. #4 is a litter-mate as is #1-#3, but lacks fluorescence from EGFP, and its pancreas was deficient upon the Cesarean section, and thus it was a non-chimeric Pdx1(−/−) mouse. Further, the spleen was removed from these newborn animals and blood cells prepared therefrom were dyed with a monoclonal antibody against murine or rat CD45, and analyzed with a flow cytometer. As a result, in litter numbers #1-#3, rat CD45 positive cells were observed in addition to murine CD45 positive cells, and thus it was confirmed that these are heterologous chimera between mouse and rat containing cells derived from the host mouse and rat iPS cells. Furthermore, almost all cells in the rat CD45 positive cell fractions exhibited fluorescence of EGFP, and thus the rat CD45 positive cell are derived from rat iPS cells marked with EGFP.

[0071] FIG. 20B shows confirmation of Pdx1 gene type by PCR with host mice litter No. #1 to #3. In order to confirm gene type of the host mice, murine CD45 positive cells, which are encompassed by dotted lines in FIG. 10, were collected and genomic DNA was extracted therefrom and PCR was conducted using primers which allow distinction between Pdx1 mutant allele and wild-type allele. As a result, in #1 and #2, only bands corresponding to mutant type were observed, and in litter No. #3, both bands of mutant type and the wild-type were detected. Therefore, it is understood that the genotype of the host is Pdx1(−/−) in #1 and #2, and in the litter No. #3, it is Pdx1(+/−). From these results, the present inventors have succeeded in the generation of rat pancreas in an individual mouse by applying heterologous blastocyst complementation technology using rat iPS cell as a donor in mice No. #1 and #2, Pdx1(−/−) mice, which should not originally have generated pancreases.

DESCRIPTION OF SEQUENCE LISTING

[0072] (Description of Sequence Listing)

[0073] (SEQ ID NO:1) primer 1 (wild type allele): agctaaagctgccagagtgc

[0074] (SEQ ID NO:2) primer 2 (common): caacttgcgattgccataaa

[0075] (SEQ ID NO:3) primer 3 (mutant allele): gcgttggctacccgtgata

[0076] (SEQ ID NO:4) nested PCR primer 1 (wild type allele): agaatgtcgcccgaggttg

[0077] (SEQ ID NO:5) nested PCR primer 2 (common): tacagcaagctaggagcac

[0078] (SEQ ID NO:6) nested PCR primer 3 (mutant allele): aagagcttggcggcgaatg

[0079] (SEQ ID NO:7) forward primer of Example 2: CAATGATGGCTCCAGGGTAA

[0080] (SEQ ID NO:8) reverse primer of Example 2: TGACTTTCTGTGCTCAGAGG

[0081] (SEQ ID NO: 9) Forward Primer for detection of cell derived from injected embryo (mutant and wild type): ATT GAG ATG AGA ACC GGC ATG

[0082] (SEQ ID NO: 10) Reverse Primer for detection of cell derived from injected embryo (mutant): TTC AAC ATC ACT GCC AGC TCC

[0083] (SEQ ID NO: 11) Reverse Primer for detection of cell derived from injected embryo (wild type): TGT GAG CGA GTA ACA ACC

CLAIMS

1.A method for producing a target organ in the living body of a non-human mammal having an abnormality associated with a lack of development of the target organ in the development stage, the target organ being derived from an allogeneic and/or xenogeneic mammal that is an individual different from the non-human mammal, the method comprising:
a) preparing a cell derived from the allogeneic and/or xenogeneic mammal;
b) transplanting the cell into a blastocyst stage fertilized egg of the non-human mammal;
c) developing the fertilized egg in the womb of a non-human surrogate parent mammal to obtain a litter; and
d) obtaining the target organ from an individual of the litter.

2.The method according to claim 1, wherein the cell is an embryonic stem cell (ES cell) or an induced pluripotent stem cell (iPS cell).

3.The method according to claim 1, wherein the cell is derived from a mouse.

4.The method according to claim 1, wherein the organ to be produced is selected from a kidney, a pancreas, thymus and hair.

5.The method according to claim 1, wherein the non-human mammal is a mouse.

6.The method according to claim 1, wherein the mouse is a Sall1 knockout mouse, a Pdx-1 knockout mouse, or a nude mouse.

7.The method according to claim 1, wherein the target organ is completely derived from the allogeneic and/or xenogeneic mammal.

8.The method according to claim 1, wherein the cell is derived from a rat.

9.The method according to claim 1, wherein the cell and the non-human mammal are heterologous to each other.

10.The method according to claim 1, wherein the cell is from a rat, and the non-human mammal is from a mouse.

11.A non-human mammal having an abnormality associated with a lack of development of a target organ in the development stage, produced according to a method comprising:
a) preparing a cell derived from an allogeneic and/or xenogeneic mammal that is an individual different from the non-human mammal;
b) transplanting the cell into a blastocyst stage fertilized egg of the non-human mammal; and
c) developing the fertilized egg in the womb of a non-human surrogate parent mammal to obtain a litter.

12.Use of a non-human mammal having an abnormality associated with a lack of development of a target organ in the development stage, for the generation of the target organ.

13.A set for producing a target organ, the set comprising:
A) a non-human mammal having an abnormality associated with a lack of the target organ development in the development stage; and
B) a cell derived from an allogeneic and/or xenogeneic mammal of the same species as the non-human mammal.

14.The set according to claim 13, wherein the cell and the non-human mammal are heterologous to each other.

15.The method according to claim 1, wherein the cell is from a rat, and the non-human mammal is from a mouse.

ABSTRACT

An object of the present invention is to produce a mammalian organ having a complicated cellular composition composed of multiple kinds of cells, such as kidney, pancreas, thymus and hair, in the living body of a non-human animal. The inventors of the present invention applied the chimeric animal assay described above, to a novel solid organ production method. More specifically, the inventors has shown that a model mouse which is deficient of kidney, pancreas, thymus or hair due to the dysfunction of the metanephric mesenchyme that is differentiated into most of an adult kidney, is rescued by blastocyst complementation by the chimeric animal assay, and whereby a kidney, a pancreas, thymus or hair can be newly produced.

Review with Gen AI

We can use Gen AI to proofread your document. This feature is only available via our Word add-in so please use the proofreading tool from our Word add-in.

Loading...